View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0651_low_17 (Length: 206)
Name: NF0651_low_17
Description: NF0651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0651_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 3638329 - 3638163
Alignment:
Q |
19 |
atgaataagaagataggaggagtaatggtgatgtcgggcacttttgtctgatttaagcatataagagcacctaggagatcgttgaagaactatattctca |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3638329 |
atgaataagaagataggaggagtaatggtgatgtcgggcacttttgtctgatttaagcatataagagcacctaggagatcgttgaagaactatattctca |
3638230 |
T |
 |
Q |
119 |
catggtgaacaaaaatagataacgaaaaggaggttcttttactttagtctaggcttcatctcaatca |
185 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3638229 |
catggtgaacaaaaatagataacgaaaaggaggttcttttactttagtctaggcttcatctcaatca |
3638163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University