View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0651_low_6 (Length: 302)
Name: NF0651_low_6
Description: NF0651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0651_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 6352724 - 6352508
Alignment:
Q |
1 |
tttttatgccgttgatcatcctacctagtcccatatggattccacccgcgacacttttctttctcttcaccgccatgtttttgtctgcttgcggatttgt |
100 |
Q |
|
|
|||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6352724 |
tttttatgccattgatcatcctaactagtcccatatggattccaaccgcgacacttttctttctcttcaccgccatgtttttgtctgcttgcggatttgt |
6352625 |
T |
 |
Q |
101 |
tgttgctgtggtgactatcctttatcaggcttacagctactacatgcgacgccaaccgcaaagcaaatgaagtagacctcaacatggttttaaattgcag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6352624 |
tgttgctgtggtgactatcctttatcaggcttacagctactacatgcgacgccacccgcaaagcaaatgaagtagacctcaacatggttttaaattgcag |
6352525 |
T |
 |
Q |
201 |
tctatcaccgcaattaaa |
218 |
Q |
|
|
|| || |||||||||||| |
|
|
T |
6352524 |
tc-atgaccgcaattaaa |
6352508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3153 times since January 2019
Visitors: 4029