View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0651_low_9 (Length: 259)

Name: NF0651_low_9
Description: NF0651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0651_low_9
NF0651_low_9
[»] chr6 (1 HSPs)
chr6 (171-219)||(6647766-6647814)


Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 6647766 - 6647814
Alignment:
171 tgaccgggctgcgattcgactcgagcaagaaagaagccgatcattgaat 219  Q
    |||||||| || |||||||||||||||||||||||||||||||||||||    
6647766 tgaccgggatgtgattcgactcgagcaagaaagaagccgatcattgaat 6647814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University