View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0651_low_9 (Length: 259)
Name: NF0651_low_9
Description: NF0651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0651_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 6647766 - 6647814
Alignment:
| Q |
171 |
tgaccgggctgcgattcgactcgagcaagaaagaagccgatcattgaat |
219 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6647766 |
tgaccgggatgtgattcgactcgagcaagaaagaagccgatcattgaat |
6647814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3035 times since January 2019
Visitors: 4024