View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_17 (Length: 337)
Name: NF0652_low_17
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 29 - 313
Target Start/End: Complemental strand, 49375692 - 49375409
Alignment:
| Q |
29 |
tgtttaaactttagaaaatgcagtgtgagatgagcaaaacacacgttgcttggtatgggatgagaaagaaattttagggctctttcaaatagtgaatgag |
128 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375692 |
tgtttaaagtttagaaaatgcagtgtgagatgagcaaaacacacgttgcttggtatgggatgagaaagaaattttagggctctttcaaatagtgaatgag |
49375593 |
T |
 |
| Q |
129 |
aaaaataggagcatggtatgagttaggatgttggcgtgggaaataaaaatggggtgtatttagcagtgcatgtagaaaattgcaaagaaaaaagtttgtt |
228 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375592 |
aaaaataggagtatggtatgagttaggatgttggcgtgggaaataaaaatggggtgtatttagcagtgcatgtagaaaattgcaaagaaaaaagtttgtt |
49375493 |
T |
 |
| Q |
229 |
aactttgggcttcaatcgagaacagaaacagaactagtcgtccacagccacttctcaacggcatttatagaagactgttactttt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
49375492 |
aactttgggcttcaatcgagaacagaaacaggactagtcatccatagccacttctcaacggcatttata-aagactattactttt |
49375409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University