View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_22 (Length: 306)
Name: NF0652_low_22
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 231
Target Start/End: Complemental strand, 35365265 - 35365047
Alignment:
| Q |
13 |
tgtttaattaacgtacgggtgcagaaattttatgatttgggaggtcgtaatgttcttgtaatgggcatgggaccaatgggatgttgtattcctatagagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35365265 |
tgtttaattaacgtacgggtgcagaaattttatgatttgggaggtcgtaatgttcttgtaatgggcatgggaccaatgggatgttgtattcctatagagt |
35365166 |
T |
 |
| Q |
113 |
tacctttatggagtaataacggtgattgtgatgttgaactcgtgagtgctgcctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35365165 |
tacctttatggagtaataacggtgattgtgatgttgaactcgtgagtgctgcctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacac |
35365066 |
T |
 |
| Q |
213 |
agagattggtgatgatgtc |
231 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
35365065 |
agagattggtgctgatgtc |
35365047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 29 - 231
Target Start/End: Complemental strand, 35376790 - 35376591
Alignment:
| Q |
29 |
gggtgcagaaattttatgatttgggaggtcgtaatgttcttgtaatgggcatgggaccaatgggatgttgtattcctatagagttacctttatggagtaa |
128 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||| ||||| |||||||||||| ||| ||| ||| ||||||| |||| | |||| |
|
|
| T |
35376790 |
gggtgcagaaactttatgatttgggaggtcgtaaggttcttgtaacgggcacgggaccaatggggtgt-gta--cctgcagagttagctttgagaagtag |
35376694 |
T |
 |
| Q |
129 |
taacggtgattgtgatgttgaactcgtgagtgctgcctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacacagagattggtgatgat |
228 |
Q |
| |
|
|| |||||||||||||| ||||||||||| |||||||| |||||| ||| |||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35376693 |
aaatggtgattgtgatgtggaactcgtgagagctgcctccttatataatccacaacttgtcgaaatgatcaaagaactcaacacagagattggttctgat |
35376594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 133 - 231
Target Start/End: Complemental strand, 35358111 - 35358013
Alignment:
| Q |
133 |
ggtgattgtgatgttgaactcgtgagtgctgcctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacacagagattggtgatgatgtc |
231 |
Q |
| |
|
||||||||||||| |||||| |||| ||||| || |||||| ||| |||| |||| ||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
35358111 |
ggtgattgtgatgcggaactcatgagagctgcgtccttatataatccacaacttgttcaaatgatcacacaactcaacagagagattggtgatgatgtc |
35358013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University