View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_26 (Length: 276)
Name: NF0652_low_26
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 51 - 231
Target Start/End: Original strand, 28530270 - 28530450
Alignment:
| Q |
51 |
catcaccaagaggtgtatttgaggtacctatttcagattccgacagcacggggagcagcaactacagcaatggaggtaaaccatcatcaccaggaggagg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530270 |
catcaccaagaggtgtatttgaggtacctatttcggattccgacagcacggggagcagcaactacagcaatggaggtaaaccatcatcaccaggaggagg |
28530369 |
T |
|
| Q |
151 |
agatggagggcaccaatggaaggctatgattgatgcattgaggtttaagtctgtgaggagattttctaccattcctatgct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
28530370 |
agatggagggcaccaatggaaggctatgattgatgcattgaggtttaagtctgtgaggagattttctagcattcctttgct |
28530450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University