View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_27 (Length: 268)
Name: NF0652_low_27
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 48 - 268
Target Start/End: Original strand, 34139646 - 34139866
Alignment:
| Q |
48 |
gtgctgctggtattgggctttttattgcttttgtgggccttcaagttaaccaaggtgttgggcttattgggcctgatccggctaatttggttacgatgac |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139646 |
gtgctgctggtattgggctttttattgcttttgtgggccttcaagttaaccaaggtgttgggcttattgggcctgatccggctaatttggttacgatgac |
34139745 |
T |
|
| Q |
148 |
ggcctgtaaaagtatcgacccggaaactggggcttgtttgggtggtaagttgcaaagcccaaagttctggcttggagcttttggttttcttatcacaagc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139746 |
ggcctgtaaaagtatcgacccggaaactggggcttgtttgggtggtaagttgcaaagcccaaagttctggcttggagcttttggttttcttatcacaagt |
34139845 |
T |
|
| Q |
248 |
tatggtttaatgaagaatatt |
268 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34139846 |
tatggtttaatgaagaatatt |
34139866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University