View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_31 (Length: 256)
Name: NF0652_low_31
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 40 - 227
Target Start/End: Original strand, 18721738 - 18721924
Alignment:
| Q |
40 |
aagctaggttttattcagattttacattggttttgctgtttttaatgtgaaaaatgtaagtttactgtttcacttgcagcaattgatcctttatgttttt |
139 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18721738 |
aagctaggttttattcagattttagattggttttgctgtttttaatgtgaaaa-tgtaaggtcactgtttcacttgcagcaattgatcctttatgttttt |
18721836 |
T |
 |
| Q |
140 |
gaaacatgacannnnnnngtaacttgagtgttatgtttttgcttagtgatgttttttgttaaaagtagatttaatttaaagtgaaatg |
227 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18721837 |
gaaacataacatttttttgtaacttgagtgttatgtttttgcttagtgatgttttttgttaaaagtagatttaatttaaagtgaaatg |
18721924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University