View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_35 (Length: 251)
Name: NF0652_low_35
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_35 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 16027496 - 16027739
Alignment:
| Q |
17 |
atggacatcatctaaaggttcacaatgccaattatctaacaagaaattgatagtctttccatcacccaaatgtcatctagagttgtcgtgaacagctaag |
116 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
16027496 |
atggtcatcaactaaaggttcacaatgccaattatcaaacaagaatttgatagtctttccatcacccaactgtcatctagagctgtcgtgaacaactaag |
16027595 |
T |
 |
| Q |
117 |
attttacatttgatacctcacaaatagaagaataaatattgtgtggtttataaaaaccataatttttagtcacccttaatctaaggaaa-tatctca--- |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16027596 |
attttacatttgatacctcacaaatagaagaataaatattgtgtggtttataaaaaccattatttttagtcacccttaatctaaggaaactatctcattc |
16027695 |
T |
 |
| Q |
213 |
-----catatttaagaaacttccaacataatttgagaccaagac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16027696 |
attatcatatttaagaaacttccaacataatttgagaccaagac |
16027739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 14608137 - 14608182
Alignment:
| Q |
17 |
atggacatcatctaaaggttcacaatgccaattatctaacaagaaa |
62 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14608137 |
atggtcatcaactaaaggttcacaatgccaattatctaacaagaaa |
14608182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University