View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_38 (Length: 250)
Name: NF0652_low_38
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 29157699 - 29157920
Alignment:
| Q |
4 |
tgatggattggccagatgcatattagtagtggttttcataatgagtctatgtctaatttactactcccgtagaggctgttagtttaattctttggtaaag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29157699 |
tgatggattggccagatgcatattagtagtggttttcgtaatgggtctatgtctaatttactactcccgtagaggctgttagtttaattctttggtaaag |
29157798 |
T |
 |
| Q |
104 |
cagtgtggcaaaaagataaatgtttcaaatcttcgattcttcaatggatgtctagtcatcttgcttgtttagccattggtggattatttgatttagtcta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29157799 |
cagtgtggcaaaaagataaatgtttcaaatcttcgattcttcaatggatgtctagtcatcttgcttgtttagccattggtggattatttgatttagtcta |
29157898 |
T |
 |
| Q |
204 |
tgcagtggtagttttatatgat |
225 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
29157899 |
tgtagtggtagttttatatgat |
29157920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 53 - 205
Target Start/End: Complemental strand, 28624907 - 28624755
Alignment:
| Q |
53 |
tgtctaatttactactcccgtagaggctgttagtttaattctttggtaaagcagtgtggcaaaaagataaatgtttcaaatcttcgattcttcaatggat |
152 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| || |||| ||||||||| |
|
|
| T |
28624907 |
tgtctaatttactactcccgtacaggctgttagtttaattctttggtaaagcagtgtgggaaaaagaaaaatgtttcaaatatttgattgctcaatggat |
28624808 |
T |
 |
| Q |
153 |
gtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatg |
205 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||| ||||||||| |||||| |
|
|
| T |
28624807 |
gtctaatcatcttgcttgtttcagcatttgtggattctttgatttaatctatg |
28624755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 143 - 217
Target Start/End: Complemental strand, 11982217 - 11982143
Alignment:
| Q |
143 |
ttcaatggatgtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatgcagtggtagttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11982217 |
ttcaatggatgtctagtcatcttgcttgtttagccattggtggattatttgatttagtttatgcagtggtagttt |
11982143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 143 - 217
Target Start/End: Original strand, 18770394 - 18770468
Alignment:
| Q |
143 |
ttcaatggatgtctagtcatcttgcttgtttagccattggtggattatttgatttagtctatgcagtggtagttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18770394 |
ttcaatggatgtctagtcatcttgcttgtttagccattggtggattatttgatttagtttatgcagtggtagttt |
18770468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University