View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0652_low_9 (Length: 405)
Name: NF0652_low_9
Description: NF0652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0652_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 249 - 381
Target Start/End: Original strand, 27720167 - 27720299
Alignment:
| Q |
249 |
gatgatggagggtgagggttttgggaaccttgggtttagagagagctgagaggaaatcgaagttgagataggaatttgggtcgggaatttggtcgggttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27720167 |
gatgatggagggtgagggttttgggaaccttgggtttagagagagttgagaggaaatcgaagttgagataggaatttgggtcgggaatttgatcgggttt |
27720266 |
T |
 |
| Q |
349 |
ctgggaagtgttgtggttgtcgtgaaattgatg |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27720267 |
ctgggaagtgttgtggttgtcgtgaaattgatg |
27720299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 30 - 182
Target Start/End: Original strand, 27719938 - 27720100
Alignment:
| Q |
30 |
cgggtgccatttctgtgtgttgaaaaagtagagattattaacaatcccaa----------gnnnnnnnccacataaaacgcaacacaacgcaccaaagca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
27719938 |
cgggtgccatttctgtgtgttgaaaaagtagagattattaacaatcccaaaacgaggttagaaaaaaaccacataaaacgcaacaaaacgcaccaaagca |
27720037 |
T |
 |
| Q |
120 |
agacgaatgtaattagagcgaatagtatcatcatttgcatcgtaatccacttctaatatcttg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27720038 |
agacgaatgtaattagagcgaatagtatcatcatttgcatcgtaatccacttctaatatcttg |
27720100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University