View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653-Insertion-6 (Length: 262)
Name: NF0653-Insertion-6
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0653-Insertion-6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 262
Target Start/End: Original strand, 1532598 - 1532867
Alignment:
| Q |
8 |
tgtctcgtgactctgaacatgaaaacttgcggtgctgagaccctaatcaagacagaccattagtgcatatcttaatagtaacaattcatgcctacatcat |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1532598 |
tgtctcgtgactctgaacatgaaaatttgtggtgctgagaccctaatcaagacagaccattagtgcatatcttaacagtaacaattcatgcctacatcat |
1532697 |
T |
|
| Q |
108 |
tgatgatgtttggtgaattttttccccaatgat-------------atgaattactgtcctt--ttcttctttcaattacccttttctgagggcattgta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| || || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1532698 |
tgatgatgtttggtgaattttttccccaatgatatgaattatgaagatgaattactttcttttcttcttctttcaattacccttttctgagggcattgta |
1532797 |
T |
|
| Q |
193 |
tgcaagatttaaatggtatttgacggcaacaccgtcgcgatcgaagtacataaatggtatttgagggcag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1532798 |
tgcaagatttaaatggtatttgacggcaacaccgtcgcgatcgaagtacataaatggtatttgagggcag |
1532867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 148
Target Start/End: Complemental strand, 7314948 - 7314898
Alignment:
| Q |
98 |
cctacatcattgatgatgtttggtgaattttttccccaatgatatgaatta |
148 |
Q |
| |
|
||||||||||||||||||||| | ||| |||| ||||||||||||||||| |
|
|
| T |
7314948 |
cctacatcattgatgatgttttctaaatatttttcccaatgatatgaatta |
7314898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 83
Target Start/End: Complemental strand, 7315009 - 7314977
Alignment:
| Q |
51 |
taatcaagacagaccattagtgcatatcttaat |
83 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
7315009 |
taataaagacagaccattagtgcatatcttaat |
7314977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 410 times since January 2019
Visitors: 4084