View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653_low_36 (Length: 313)
Name: NF0653_low_36
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0653_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 29 - 303
Target Start/End: Complemental strand, 32229761 - 32229488
Alignment:
| Q |
29 |
agaatggtagttttcatatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcattttttccttcttgtatttcttaatctt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32229761 |
agaatggtagttttcatatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcattttttt-ttcttgtatttcttaatctt |
32229663 |
T |
 |
| Q |
129 |
caacaaatttaagtcacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229662 |
caacaaatttaagtcacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtatg |
32229563 |
T |
 |
| Q |
229 |
ttgttgattaatttgatattgttcagggtttgttgatggtacatgaatgattaattgtttgtttctttgtctgtg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32229562 |
ttgttgattaatttgatattgttcagggtttgttgatggtacatgaatgattaattgtttgtttctttgtttgtg |
32229488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University