View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653_low_38 (Length: 305)
Name: NF0653_low_38
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0653_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 81 - 256
Target Start/End: Original strand, 32131668 - 32131841
Alignment:
| Q |
81 |
tcaaacctgtgcaaagttcgatgccacaactttaaactaaagataaaatgtgatactttcaaaataagcacataagtaagcatattccaagtgtgttatt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32131668 |
tcaaacctgtgcaaagttcgatgccacaactttaaactaaagataaaatgtgatactttcaaaataagcacataagt--gcatattccaagtgtgttatt |
32131765 |
T |
 |
| Q |
181 |
acttttaacttggggttcaattttatattacannnnnnnnnnnnnatagttggccaccccaatcattctattttgg |
256 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32131766 |
atttttaacttggggttcaattttatattacattttttattttttatagttggccaccccaatcattctattttgg |
32131841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 274 - 305
Target Start/End: Original strand, 32131877 - 32131908
Alignment:
| Q |
274 |
gatttgtatttgcttatgacatttcatatagt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32131877 |
gatttgtatttgcttatgacatttcatatagt |
32131908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University