View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653_low_39 (Length: 304)
Name: NF0653_low_39
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0653_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 23 - 151
Target Start/End: Original strand, 41955454 - 41955582
Alignment:
| Q |
23 |
atcatcattatagtgtagaaatagaaatacacgagttatcaaattaatttctgtatattatcgaagtatttatataaatgctaaataatatactttacac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41955454 |
atcatcattatagtgtagaaatagaaatacacgaattatcaaattaatttctgtatattatcgaagtatttatataaatgctacataatatactttacac |
41955553 |
T |
 |
| Q |
123 |
ttaagaactttactcgaagatgcatgctc |
151 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
41955554 |
ttaagaactttacttgaagatgcatgctc |
41955582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 174 - 282
Target Start/End: Original strand, 41955666 - 41955774
Alignment:
| Q |
174 |
ttattagccaggttcaccatgcatgggtatattaactcccatcatttttaacccaaaagaaaaccaaataaataaaagcctatccattactcacgataat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41955666 |
ttattagccaggttcaccatgcatgggtatattaactcccatcatttttaacccaaaagaaaaccaaataaataaaagcttatccattactcacgataat |
41955765 |
T |
 |
| Q |
274 |
attgatgat |
282 |
Q |
| |
|
||||||||| |
|
|
| T |
41955766 |
attgatgat |
41955774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University