View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653_low_51 (Length: 272)
Name: NF0653_low_51
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0653_low_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 98 - 272
Target Start/End: Complemental strand, 10258907 - 10258733
Alignment:
| Q |
98 |
atgaaggccctccaattctttaggaacgctcatagatttgcgttcaggtgaagcaattgttcctatttcggcattcaccggaacaagagcaccacttttg |
197 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258907 |
atgaaggccctctaattctttaggaacgcacatagatttgcgttcaggtgaagcaaccattcctatttcggcattcaccggaacaagagcaccacttttg |
10258808 |
T |
 |
| Q |
198 |
ctatctaaacccaaaaattgatctttatcgaaggaaagatttctagagggcaactgcattgcccattggaccact |
272 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258807 |
ctatctagacccaaaaattgatctttatcaaaggaaagatttctagagggcaactgcattgcccattggaccact |
10258733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University