View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0653_low_55 (Length: 248)

Name: NF0653_low_55
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0653_low_55
NF0653_low_55
[»] chr3 (1 HSPs)
chr3 (1-127)||(48320679-48320805)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 48320805 - 48320679
Alignment:
1 tctcctttcactttcacaatccaacgaattctgttaaactttcatcggtggcggcgctttcatcttcttctagcgccgctactgccatcatcaccatccc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||    
48320805 tctcctttcactttcacaatccaacgaattctgttaaactttcatcagtggcggcgctttcatcttcttctagcgccgctactgccatcatcaccattcc 48320706  T
101 ataattttgtttcaaccaacgtaaatt 127  Q
    |||||||||||||||||||||||||||    
48320705 ataattttgtttcaaccaacgtaaatt 48320679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University