View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0653_low_62 (Length: 221)

Name: NF0653_low_62
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0653_low_62
NF0653_low_62
[»] chr1 (1 HSPs)
chr1 (1-148)||(46901305-46901452)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 46901452 - 46901305
Alignment:
1 aggagtagcagtagcatcaggattattcctcatctcagcactagccaccccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46901452 aggagtagcagtagcatcaggattattcctcatctcagcactagccaccccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgtt 46901353  T
101 gctccggtcagaacatctcccatcttaatcttctcctcctcacgttga 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
46901352 gctccggtcagaacatctcccatcttaatcttctcctcctcacgttga 46901305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 945 times since January 2019
Visitors: 4105