View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653_low_62 (Length: 221)
Name: NF0653_low_62
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0653_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 46901452 - 46901305
Alignment:
Q |
1 |
aggagtagcagtagcatcaggattattcctcatctcagcactagccaccccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgtt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46901452 |
aggagtagcagtagcatcaggattattcctcatctcagcactagccaccccagcagcatcttgccttgtcgccgccttatcagctggcagcttcgctgtt |
46901353 |
T |
 |
Q |
101 |
gctccggtcagaacatctcccatcttaatcttctcctcctcacgttga |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46901352 |
gctccggtcagaacatctcccatcttaatcttctcctcctcacgttga |
46901305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University