View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0653_low_64 (Length: 212)
Name: NF0653_low_64
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0653_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 31608447 - 31608646
Alignment:
Q |
1 |
cttcgctttctgtgctacccgttggttcaccatcatgggaattgatcgtcgattgcggatcagtccctaaatcttcgcttcctgtgctacccgttggttc |
100 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
31608447 |
cttcgcttcctgtgctacccgttggttcaccatcatgggaatcgatcgtcgattgcggatcagtccccaaatcttcgcttcctgtgctacccgttggttc |
31608546 |
T |
 |
Q |
101 |
acctattggtcgtcgattgatagtcgattgcggatcagtccccaatcctcctcctggtctaactattggtttcattgcataaacttttgttttgtttttg |
200 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31608547 |
acctattggtcgtcgattgattgtcgattgcggatcagtccccaatcctcctcctggtctaactattggtttcattgcataaacttttgttttgtttttg |
31608646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 53 - 103
Target Start/End: Original strand, 31608427 - 31608477
Alignment:
Q |
53 |
ttgcggatcagtccctaaatcttcgcttcctgtgctacccgttggttcacc |
103 |
Q |
|
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
31608427 |
ttgcggatcagtccccaaaccttcgcttcctgtgctacccgttggttcacc |
31608477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 200
Target Start/End: Original strand, 31612963 - 31613038
Alignment:
Q |
128 |
ttgcggatcagtccccaatcctcc---tcctggtctaactattggtttcattgcataaacttttgttttgtttttg |
200 |
Q |
|
|
|||||||||||||||||||||||| ||||| ||| ||||||||||| ||| || ||||||||||||||||||| |
|
|
T |
31612963 |
ttgcggatcagtccccaatcctccgcttcctgtgctacctattggtttctttggattaacttttgttttgtttttg |
31613038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University