View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0653_low_64 (Length: 212)

Name: NF0653_low_64
Description: NF0653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0653_low_64
NF0653_low_64
[»] chr2 (3 HSPs)
chr2 (1-200)||(31608447-31608646)
chr2 (53-103)||(31608427-31608477)
chr2 (128-200)||(31612963-31613038)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 31608447 - 31608646
Alignment:
1 cttcgctttctgtgctacccgttggttcaccatcatgggaattgatcgtcgattgcggatcagtccctaaatcttcgcttcctgtgctacccgttggttc 100  Q
    |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
31608447 cttcgcttcctgtgctacccgttggttcaccatcatgggaatcgatcgtcgattgcggatcagtccccaaatcttcgcttcctgtgctacccgttggttc 31608546  T
101 acctattggtcgtcgattgatagtcgattgcggatcagtccccaatcctcctcctggtctaactattggtttcattgcataaacttttgttttgtttttg 200  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31608547 acctattggtcgtcgattgattgtcgattgcggatcagtccccaatcctcctcctggtctaactattggtttcattgcataaacttttgttttgtttttg 31608646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 53 - 103
Target Start/End: Original strand, 31608427 - 31608477
Alignment:
53 ttgcggatcagtccctaaatcttcgcttcctgtgctacccgttggttcacc 103  Q
    ||||||||||||||| ||| |||||||||||||||||||||||||||||||    
31608427 ttgcggatcagtccccaaaccttcgcttcctgtgctacccgttggttcacc 31608477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 200
Target Start/End: Original strand, 31612963 - 31613038
Alignment:
128 ttgcggatcagtccccaatcctcc---tcctggtctaactattggtttcattgcataaacttttgttttgtttttg 200  Q
    ||||||||||||||||||||||||   |||||  ||| ||||||||||| ||| || |||||||||||||||||||    
31612963 ttgcggatcagtccccaatcctccgcttcctgtgctacctattggtttctttggattaacttttgttttgtttttg 31613038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University