View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654-Insertion-1 (Length: 125)
Name: NF0654-Insertion-1
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0654-Insertion-1 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 34686153 - 34686270
Alignment:
| Q |
8 |
tcattctctttggagttttcttgttcacaactgtcagaaactgcacttaaaatcttcgcagccctgagttgtgaatcctttgagactcctattgtgttta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34686153 |
tcattctctttggagttttcttgttcacaactgtcagaaactgcacttaaaatctttgcagccctgagttgtgaatcctttgagactcctattgtgttta |
34686252 |
T |
|
| Q |
108 |
gctctatgaacttggtca |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34686253 |
gctctatgaacttggtca |
34686270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 25 - 117
Target Start/End: Original strand, 43611947 - 43612039
Alignment:
| Q |
25 |
ttcttgttcacaactgtcagaaactgcacttaaaatcttcgcagccctgagttgtgaatcctttgagactcctattgtgtttagctctatgaa |
117 |
Q |
| |
|
||||| ||| || |||||||| ||||| | |||| ||| ||||| |||||||| |||||||| ||||| || ||||| || ||||||||||| |
|
|
| T |
43611947 |
ttcttcttcgcagctgtcagacactgctttcaaaaccttggcagctctgagttgagaatccttggagacaccaattgtattcagctctatgaa |
43612039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2596 times since January 2019
Visitors: 4010