View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654-Insertion-2 (Length: 102)
Name: NF0654-Insertion-2
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0654-Insertion-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35648883 - 35648975
Alignment:
| Q |
8 |
gtttctaaggttgtatcagtctttcatgattgagttatatattcaacaattatatttggacatttcaaatttttctaccccattcaacatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
35648883 |
gtttctaaggttgtatcagtctttcatgattgagttatatattcaacaattatatatggacattttaaatttttctaccccattcaagatctt |
35648975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University