View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0654-Insertion-2 (Length: 102)

Name: NF0654-Insertion-2
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0654-Insertion-2
NF0654-Insertion-2
[»] chr5 (1 HSPs)
chr5 (8-100)||(35648883-35648975)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 35648883 - 35648975
Alignment:
8 gtttctaaggttgtatcagtctttcatgattgagttatatattcaacaattatatttggacatttcaaatttttctaccccattcaacatctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||    
35648883 gtttctaaggttgtatcagtctttcatgattgagttatatattcaacaattatatatggacattttaaatttttctaccccattcaagatctt 35648975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2649 times since January 2019
Visitors: 4010