View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654-Insertion-3 (Length: 73)
Name: NF0654-Insertion-3
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0654-Insertion-3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 15628595 - 15628529
Alignment:
| Q |
7 |
aatgggccatgctttttacacattaccttttcagctaaggaactcgacaactcgtaaagcttactca |
73 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15628595 |
aatgggccatgctttttactcattaccttttcagctaaggaactcgacaactcgtaaagcttactca |
15628529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 22933077 - 22933138
Alignment:
| Q |
7 |
aatgggccatgctttttacacattaccttttcagctaaggaactcgacaactcgtaaagctt |
68 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||| |||||| ||||||||| |
|
|
| T |
22933077 |
aatgggccatgctttttactctcaaccttttcagctaaagaactcaacaactggtaaagctt |
22933138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University