View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654_high_4 (Length: 228)
Name: NF0654_high_4
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0654_high_4 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 15658059 - 15657919
Alignment:
| Q |
1 |
tactcgttccagccaaatgatgcttaaccctataagcacttcctgtaaaagaaagctgacaaaatttacattgcacccttcttgatcctagttcagtaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15658059 |
tactcgttccagccaaatgatgcttaaccctataagcacttcctgtaaaagcaagctgacagaatttacattgcacccttcttgatcctggttcagtaga |
15657960 |
T |
|
| Q |
101 |
aatagcatactgccatgctggatcagttttattcccttttg |
141 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15657959 |
aatagcatactcccatgctggatcagttttattcccttttg |
15657919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 243984 - 243847
Alignment:
| Q |
1 |
tactcgttccagccaaatgatgcttaaccctataagcacttcctgtaaaagaaagctgacaaaatttacattgcacccttcttgatcctagttcagtaga |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||| ||| |||||| |||||||||| ||||| | | | |||| |
|
|
| T |
243984 |
tactcgttccagttaaatgatgcttaaccctataagcacttcctgtaaaaggaagttgacagaatctacatttcacccttctt-atcct-gcttaataga |
243887 |
T |
|
| Q |
101 |
aatagcatactgccatgctggatcagttttattccctttt |
140 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
243886 |
aatagcatactcccatgctggatcagttttatttcctttt |
243847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 3 - 141
Target Start/End: Original strand, 246478 - 246615
Alignment:
| Q |
3 |
ctcgttccagccaaatgatgcttaaccctataagcacttcctgtaaaagaaagctgacaaaatttacattgcacccttcttgatcctagttcagtagaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||| ||| |||||| || ||||||||||||| |||| ||||| |
|
|
| T |
246478 |
ctcgttccagccaaatgatgcttaaccctataagcacttcttgtaaaaggaagccgacggaatctacatttca-ccttcttgatcctgcttcaaaagaaa |
246576 |
T |
|
| Q |
103 |
tagcatactgccatgctggatcagttttattcccttttg |
141 |
Q |
| |
|
||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
246577 |
tagcatactccaatgctggatcagttttatttccttttg |
246615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 87
Target Start/End: Complemental strand, 41042844 - 41042763
Alignment:
| Q |
6 |
gttccagccaaatgatgcttaaccctataagcacttcctgtaaaagaaagctgacaaaatttacattgcacccttcttgatc |
87 |
Q |
| |
|
||||||||||| | |||||| || || |||||||||| || ||| ||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
41042844 |
gttccagccaattaatgcttcactctgtaagcacttcatgcaaatgaaagctcacaaaatttacacttcacccttcttgatc |
41042763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 41037021 - 41036933
Alignment:
| Q |
1 |
tactcgttccagccaaatgatgcttaaccctataagcacttcctgtaaaagaaagctgacaaaatttacattgcacccttcttgatcct |
89 |
Q |
| |
|
|||| ||||||||||| | ||| || || || |||||||||| ||| || ||||||| |||||||||||| | || ||||||||||||| |
|
|
| T |
41037021 |
tactagttccagccaattaatgtttcactctgtaagcacttcttgtcaatgaaagctcacaaaatttacacttcatccttcttgatcct |
41036933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2990 times since January 2019
Visitors: 4021