View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654_low_12 (Length: 273)
Name: NF0654_low_12
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0654_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 44 - 227
Target Start/End: Complemental strand, 8636435 - 8636252
Alignment:
Q |
44 |
catcatcactaacaataaaaatgtcaactttatacatactcagaaagcaaaatttaaaaattgaatcatttaatcaactgggtcgtttaaattagcaaaa |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8636435 |
catcatcactaacaataaaaatgtcaactttatacatactcagaaagcaaaatttaaaaattgaatcatttaatcaactgggtcgtttaaattagcaaaa |
8636336 |
T |
 |
Q |
144 |
ttttaaatttttcaatcacattagtactctgcagcagcacgacacttctaatcaaatatcaaattaatatgtgtttgtctgatg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8636335 |
ttttaaatttttcaatcacattagtactctgcagcagcacgacacttctaatcaaatatcaaattaatatgtgtttgtctgatg |
8636252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3239 times since January 2019
Visitors: 4030