View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654_low_17 (Length: 228)
Name: NF0654_low_17
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0654_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 1093291 - 1093469
Alignment:
| Q |
7 |
acagattgggacttaaaggctcagatagtttttagatgtagtcttgtgctttcaaactggaccaccgcctctacttacaaacaagttcctgttgtacaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1093291 |
acagattgggacttaaaggctcagatagtttttagatgtagtcttgtgctttcaaactggaccaccgcctctacttacaaacaagttcctgttgtacaca |
1093390 |
T |
|
| Q |
107 |
caggcagatctagctgaaaaaacaaagatatttgttgctggataggttagatatggccataaataatgacaaatccttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1093391 |
caggcagatctagctgaaaaaacaaagatatttgttgctggataggttagatatggccataaataatgacaaatccttt |
1093469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3172 times since January 2019
Visitors: 4029