View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0654_low_9 (Length: 292)
Name: NF0654_low_9
Description: NF0654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0654_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 5235381 - 5235349
Alignment:
Q |
77 |
attcaaagtagacaacaatacgttagaaaaatg |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
5235381 |
attcaaagtagacaacaatacgttagaaaaatg |
5235349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 60 - 109
Target Start/End: Complemental strand, 5184025 - 5183976
Alignment:
Q |
60 |
gtaagaacgcatataagattcaaagtagacaacaatacgttagaaaaatg |
109 |
Q |
|
|
|||||| | ||| |||||||||||||| |||||||||| ||||||||||| |
|
|
T |
5184025 |
gtaagagcacatgtaagattcaaagtaaacaacaataccttagaaaaatg |
5183976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3019 times since January 2019
Visitors: 4024