View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0655-Insertion-10 (Length: 364)
Name: NF0655-Insertion-10
Description: NF0655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0655-Insertion-10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 52 - 284
Target Start/End: Original strand, 54822149 - 54822385
Alignment:
| Q |
52 |
cgccctctttctctgcatagattgattagagagagacgacgtggcgctttgcgatttcattaatcaataggtatgcgagttttcaactcatatacgatac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
54822149 |
cgccctctttctctgcatagattgattagagagagaagacgtggcgctttgcgatttcattaatcaataggtacgcgagttttcaactcatatatgatac |
54822248 |
T |
 |
| Q |
152 |
gatgattctctgtattgtattcgcttaatttcattttcgttaataataaatattaattaa----aatcannnnnnngtgggtcttgactttgaataccgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
54822249 |
gatgattctctgtattgtattcgcttaatttcattttcgttaataataaatattaattaattaaaatcatttttttgtgggtcttgactttgaataccgt |
54822348 |
T |
 |
| Q |
248 |
tttttcagcatttatttcggatccttctttctgactg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54822349 |
tttttcagcatttatttcggatccttctttctgactg |
54822385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 309 - 364
Target Start/End: Original strand, 54822384 - 54822439
Alignment:
| Q |
309 |
tgggatcttatgtttcctctatttatatatttattcacttttcactgtctaccaga |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54822384 |
tgggatcttatgtttcctctatttatatatttattcacttttcactgtctatcaga |
54822439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University