View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0655-Insertion-13 (Length: 289)
Name: NF0655-Insertion-13
Description: NF0655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0655-Insertion-13 |
 | |
|
| [»] scaffold0443 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 118 - 266
Target Start/End: Original strand, 33383000 - 33383148
Alignment:
| Q |
118 |
aaaaggtggcatgggactcaaaaccacttctgagttgggtaaagagaaaaacagatattttactattattgagtgtgacgcatggatggattgaatagtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
33383000 |
aaaaggtggcatgggactcaaaaccacttctgagttgggtaaagagaaaaacagatattttactattattgagtgtgacgcatggatggattgaatgggg |
33383099 |
T |
|
| Q |
218 |
tttgtacgtaaatgggtagatatcttgggataaattggcaaaatttggt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33383100 |
tttgtacgtaaatgggtagatatcttgggataaattggcaaaatttggt |
33383148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0443 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: scaffold0443
Description:
Target: scaffold0443; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 7 - 118
Target Start/End: Complemental strand, 7125 - 7014
Alignment:
| Q |
7 |
aatccgatcattgcactggacggaaatgagttgttatttgtcaaccgcggattcgatcggattgacgttttcggaccgtcatcgtccgaaaccgcccgtt |
106 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7125 |
aatccgatcattgcaatggacaaaaatgggttgttatttaccaaccgcgatttcgatcggattgacgttttcggaccgtcaccgtccgaaaccgcccgtt |
7026 |
T |
|
| Q |
107 |
tgtccaccccta |
118 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
7025 |
tgaccaccccta |
7014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 7 - 80
Target Start/End: Complemental strand, 25306010 - 25305937
Alignment:
| Q |
7 |
aatccgatcattgcactggacggaaatgagttgttatttgtcaaccgcggattcgatcggattgacgttttcgg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25306010 |
aatccgatcattgcactggacggaaatgggttgttatttgtcaaccgtggattcgatcggattgacgttttcgg |
25305937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 7 - 73
Target Start/End: Original strand, 25305842 - 25305908
Alignment:
| Q |
7 |
aatccgatcattgcactggacggaaatgagttgttatttgtcaaccgcggattcgatcggattgacg |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25305842 |
aatccgatcattgcactggacggaaatgggttgttatttgtcaaccgaggattcgatcggattgacg |
25305908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 41026854 - 41026939
Alignment:
| Q |
7 |
aatccgatcattgcactggacggaaatgagttgttatttgtcaaccgcggattcgatcggattgacgttttcggaccgtcatcgtc |
92 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41026854 |
aatccgatcattgcactggacagaaattggttgttatttgtcaaccgcagtttcgatcggattgacgttttcggaccgtcatcgtc |
41026939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 7 - 118
Target Start/End: Complemental strand, 21135962 - 21135851
Alignment:
| Q |
7 |
aatccgatcattgcactggacggaaatgagttgttatttgtcaaccgcggattcgatcggattgacgttttcggaccgtcatcgtccgaaaccgcccgtt |
106 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||| ||||||| ||||||||||||||| |||||||||||||| |||| |||||| |||||| |
|
|
| T |
21135962 |
aatccgatcattgcaatggacgaaaatgggttgttatttgccaaccgcaatttcgatcggattgacattttcggaccgtcaccgtctgaaaccacccgtt |
21135863 |
T |
|
| Q |
107 |
tgtccaccccta |
118 |
Q |
| |
|
|| ||| ||||| |
|
|
| T |
21135862 |
tgaccatcccta |
21135851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 115
Target Start/End: Original strand, 41415536 - 41415604
Alignment:
| Q |
47 |
tcaaccgcggattcgatcggattgacgttttcggaccgtcatcgtccgaaaccgcccgtttgtccaccc |
115 |
Q |
| |
|
||||||| || || || ||||||| | ||||||| |||||| || ||||||||| |||||||||||||| |
|
|
| T |
41415536 |
tcaaccgtgggtttgaacggattggcattttcggtccgtcaccgaccgaaaccgaccgtttgtccaccc |
41415604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2677 times since January 2019
Visitors: 4010