View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0655_low_2 (Length: 250)
Name: NF0655_low_2
Description: NF0655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0655_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 97 - 246
Target Start/End: Original strand, 42561966 - 42562114
Alignment:
| Q |
97 |
aaccaaacacaccctaaatgtaaggatctattatcaacatctcacactagttttatcgtgaaccgtgttaatgaggcaagcaaataaggttgttcattct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42561966 |
aaccaaacacaccctaaatgtaaggatctattatcaacatctcacactaattttatcgtgaaccgtgtt-atgaggcaagcaaataaggttgttcattct |
42562064 |
T |
|
| Q |
197 |
ataaccagggcatccttatctaatcttaaccctcgtatttttgatgatgt |
246 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
42562065 |
ataaccagagcatccttatctaatcttaacccccatattttttatgatgt |
42562114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3088 times since January 2019
Visitors: 4027