View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0656-Insertion-3 (Length: 211)
Name: NF0656-Insertion-3
Description: NF0656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0656-Insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 36 - 209
Target Start/End: Original strand, 7774606 - 7774783
Alignment:
Q |
36 |
actagatcttctgccagtgctgccggaggggtcataaacatctttgcaaaataatgtactacattacaatccatcacttgtacaactaattatttcttca |
135 |
Q |
|
|
|||||||||||| |||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7774606 |
actagatcttctaccagtgctgccgcacgggtcataaacatctttgcaaaataccgtactacattacaatccatcacttgtacaactaattatttcttca |
7774705 |
T |
 |
Q |
136 |
acgttggatgtataaatattttgaaaaatctctttata---tattacatttgatgttgatggaatcg-cattttcatc |
209 |
Q |
|
|
|| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||| | |||||||||| |
|
|
T |
7774706 |
acattggatgtctaaatattttgaaaaatctctttatatattattacatttgatgttgatgcaatggccattttcatc |
7774783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University