View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0656_low_11 (Length: 274)
Name: NF0656_low_11
Description: NF0656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0656_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 79 - 143
Target Start/End: Original strand, 42453863 - 42453927
Alignment:
| Q |
79 |
tgataatagggattgtggctttggctgttcctttccgatatcttgtctttgtttggtttctttat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453863 |
tgataatagggattgtggctttggctgttcctttccgatatcttgtctttgtttggtttctttat |
42453927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2810 times since January 2019
Visitors: 4016