View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0656_low_12 (Length: 260)
Name: NF0656_low_12
Description: NF0656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0656_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 37204448 - 37204648
Alignment:
| Q |
1 |
ataagcctttggattataggtctgcaagtttttggaggtctccaagctatcatttttacaagagtatggtccaaaactgagagagggatatgttacagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204448 |
ataagcctttggattataggtctgcaagtttttggaggtctccaagctatcatttttacaagagtatggtccaaaactgagagagggatatgttacagtg |
37204547 |
T |
 |
| Q |
101 |
aagcatttgtcaaatatttcacaggattctgatgtaacatgctttccatttcattggtttcacttttgtgataacaattgggcgaaggtttggttctggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37204548 |
aagcatttgtcaaatatttcacaggattctgatgtaacatgctttccatttcattggtttcacttttgtgataacaattggacgaaggtttggttctggt |
37204647 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
37204648 |
g |
37204648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 91
Target Start/End: Original strand, 37217997 - 37218041
Alignment:
| Q |
47 |
ctatcatttttacaagagtatggtccaaaactgagagagggatat |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37217997 |
ctatcttttttacaagagtatggtccaaacctgagagagggatat |
37218041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University