View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0656_low_14 (Length: 251)
Name: NF0656_low_14
Description: NF0656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0656_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 3446876 - 3447097
Alignment:
| Q |
17 |
atttgaatttagttgaataatctgtatgttgtttaggacaattaactattcttcttaacatacatctacaaaacagtgaaagaaaataaaccacgggagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446876 |
atttgaatttagttgaataatctgtatgttgtttaggacaattaactattcttcttaacatacatctacaaaacagtgaaagaaaataaaccacgggagg |
3446975 |
T |
|
| Q |
117 |
attatgacatcttacacatcaatcaagccaggcatgacaacagcatctccataatcaatcacttgatgcacagaattatccttcttgccatatccttcaa |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3446976 |
attttgacatcttacacatcaatcaagccaggcatgacaacagcatctccataatcaatcacttgatgcacagaattatccttcttgccataaccttcaa |
3447075 |
T |
|
| Q |
217 |
caatagaaactatcttcccttc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3447076 |
caatagaaactatcttcccttc |
3447097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2877 times since January 2019
Visitors: 4017