View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0656_low_16 (Length: 214)
Name: NF0656_low_16
Description: NF0656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0656_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 42323102 - 42323048
Alignment:
Q |
1 |
tgtgagatgtattctgcaccgtcttgttgtgattcaaagatgaagatgtgttgat |
55 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42323102 |
tgtgagatgtatactgcaccgtcttgttgtgattcaaagatgaagatgtgttgat |
42323048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University