View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0657_high_7 (Length: 249)

Name: NF0657_high_7
Description: NF0657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0657_high_7
NF0657_high_7
[»] chr5 (4 HSPs)
chr5 (114-238)||(15520952-15521076)
chr5 (114-238)||(15515597-15515721)
chr5 (11-85)||(15521099-15521173)
chr5 (11-84)||(15515761-15515834)
[»] chr3 (2 HSPs)
chr3 (114-162)||(3519205-3519253)
chr3 (118-179)||(43751970-43752031)
[»] chr4 (1 HSPs)
chr4 (50-84)||(29236550-29236584)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 114 - 238
Target Start/End: Complemental strand, 15521076 - 15520952
Alignment:
114 gatgcccctctaagtgtgagtccatgtgccaaggggctgattgcacttgactagggctggccctgttggtaatgtattttgagtaatggtgtcaaatgcg 213  Q
    ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15521076 gatgcccctctaagtgtgagtccctgtgccaaggggctggttgcacttgactagggctggccctgttggtaatgtattttgagtaatggtgtcaaatgcg 15520977  T
214 tatacgtatggtggaatattttcat 238  Q
    |||||||||||||||||||||||||    
15520976 tatacgtatggtggaatattttcat 15520952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 114 - 238
Target Start/End: Complemental strand, 15515721 - 15515597
Alignment:
114 gatgcccctctaagtgtgagtccatgtgccaaggggctgattgcacttgactagggctggccctgttggtaatgtattttgagtaatggtgtcaaatgcg 213  Q
    ||||||||| ||||||||||||| ||||||||||||||| ||||||||||||| ||  |  | ||||||||||||||||||||||||||||||||| |||    
15515721 gatgcccctttaagtgtgagtccttgtgccaaggggctggttgcacttgactaaggtcgatcgtgttggtaatgtattttgagtaatggtgtcaaaagcg 15515622  T
214 tatacgtatggtggaatattttcat 238  Q
    |||   |||||||||||||||||||    
15515621 tattgatatggtggaatattttcat 15515597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 11 - 85
Target Start/End: Complemental strand, 15521173 - 15521099
Alignment:
11 gacatcatcattgttgtctttcaaacatttacctgcggaacatttagtgatggattttgtccgtaggtacaagta 85  Q
    |||||||| ||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
15521173 gacatcataattgttgtcttccaaacatttacctacggaacatttagtgacggattttgtccgtaggtacaagta 15521099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 11 - 84
Target Start/End: Complemental strand, 15515834 - 15515761
Alignment:
11 gacatcatcattgttgtctttcaaacatttacctgcggaacatttagtgatggattttgtccgtaggtacaagt 84  Q
    |||| ||| ||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||| |||||||    
15515834 gacagcataattgttgtcttccaaacatttacctacggaacatttagtgacggattttgtccgtagatacaagt 15515761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 162
Target Start/End: Complemental strand, 3519253 - 3519205
Alignment:
114 gatgcccctctaagtgtgagtccatgtgccaaggggctgattgcacttg 162  Q
    |||||||||||||||||||| || |||||||||||| || |||||||||    
3519253 gatgcccctctaagtgtgaggccctgtgccaaggggttggttgcacttg 3519205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 43752031 - 43751970
Alignment:
118 cccctctaagtgtgagtccatgtgccaaggggctgattgcacttgactagggctggccctgt 179  Q
    |||||||||||||||| |  ||||||||||| ||  ||||||||| | ||||||||||||||    
43752031 cccctctaagtgtgaggcactgtgccaagggccttgttgcacttggccagggctggccctgt 43751970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 84
Target Start/End: Complemental strand, 29236584 - 29236550
Alignment:
50 acatttagtgatggattttgtccgtaggtacaagt 84  Q
    ||||||||||| |||||||||||||||||||||||    
29236584 acatttagtgacggattttgtccgtaggtacaagt 29236550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University