View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0658-Insertion-1 (Length: 614)
Name: NF0658-Insertion-1
Description: NF0658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0658-Insertion-1 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 576; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 576; E-Value: 0
Query Start/End: Original strand, 8 - 614
Target Start/End: Original strand, 5436641 - 5437248
Alignment:
Q |
8 |
cttctctccatccttcaactcaattgtcatggtttctccctcttcattaacagttcgtcatcacccaggattacgacgcagagttgtttctacgtgaatt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5436641 |
cttctctccatccttcaactcaattgtcatggtttctccctcttcattaacagttcgtcatcacccaggattacgacgcagagttgtttctacgtgaatt |
5436740 |
T |
 |
Q |
108 |
gagggtgcgggtggtagcgctgcccacatcggaaacacaaccctcgagctttacgatccattaattctgaacaagggagatgcttgcacccggattaaaa |
207 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
5436741 |
gagggtgcgggtggtagcgctccccacatcggaaacacaaccctcgagctttacgatccattaattctgaacaagggagatgcttgcacccagattaaaa |
5436840 |
T |
 |
Q |
208 |
attgacccagtttgaccagttatgggttgattactcccatttggcccaaaaatcatatttcttttacttgggtctaagtattgacccgacccatttcctt |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
5436841 |
attgacccagtttgaccagttatgggttgattactcccatttggcccaaaaatcatatttcttttacttgggcctaagtattgacccgacccatttcctt |
5436940 |
T |
 |
Q |
308 |
ccctaacgataaacccaaagttcaacctgtttcctctttt-ccctgtttggagtactttcctccatcgcttcgaggaatcagagcccctcacaattctgt |
406 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5436941 |
ccctaacgataaacccaaagttcaacctgtttcctcttttcccctgtttggagtactttcctccatcgcttcgaggaatcagagcccctcacaattctgt |
5437040 |
T |
 |
Q |
407 |
ctcaatgtcccttgccaatttcattgtctgaacccgtgtgtgaagattgatcgtcctcacctacaatcggatcactgcttggagtccactgattaaataa |
506 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5437041 |
ctcaatgtcccttgccaatttcattgtctgaacccgtgtgtgaagattgatcgtcctcacctacaatcggatcactgcttggagtccactgattaaataa |
5437140 |
T |
 |
Q |
507 |
cctagacactgatcctctgggaactatcgtacttgagaagagatattctcaaattttgatatgtactcatccactgtctcagtccgtttcaaatctttga |
606 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
T |
5437141 |
cctagacaccgatcctctgggaactatcgtacttgagaagagatattctcaaattttgatatgtactcatccaccgtctcagtctgtttcaaatctttga |
5437240 |
T |
 |
Q |
607 |
gttcttca |
614 |
Q |
|
|
|||||||| |
|
|
T |
5437241 |
gttcttca |
5437248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2657 times since January 2019
Visitors: 4010