View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0660_low_11 (Length: 232)

Name: NF0660_low_11
Description: NF0660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0660_low_11
NF0660_low_11
[»] chr2 (1 HSPs)
chr2 (1-143)||(2777714-2777856)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 2777856 - 2777714
Alignment:
1 tatgattacgcatagccaatttaaaatgaccatatgccatactagttcttaatttgcgtgtgagaaagggatacaaaccacaacaaaatcacgagagaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2777856 tatgattacgcatagccaatttaaaatgaccatatgccatactagttcttaatttgcgtgtgagaaagggatacaaaccacaacaaaatcacgagagaaa 2777757  T
101 ttgatttggagaggtgtgtgtcaaaacataaaaatgatgatgt 143  Q
    ||||||||||||| |||||||||||||||||||||||||||||    
2777756 ttgatttggagagatgtgtgtcaaaacataaaaatgatgatgt 2777714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University