View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0660_low_11 (Length: 232)
Name: NF0660_low_11
Description: NF0660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0660_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 2777856 - 2777714
Alignment:
| Q |
1 |
tatgattacgcatagccaatttaaaatgaccatatgccatactagttcttaatttgcgtgtgagaaagggatacaaaccacaacaaaatcacgagagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777856 |
tatgattacgcatagccaatttaaaatgaccatatgccatactagttcttaatttgcgtgtgagaaagggatacaaaccacaacaaaatcacgagagaaa |
2777757 |
T |
 |
| Q |
101 |
ttgatttggagaggtgtgtgtcaaaacataaaaatgatgatgt |
143 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2777756 |
ttgatttggagagatgtgtgtcaaaacataaaaatgatgatgt |
2777714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University