View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0660_low_2 (Length: 442)
Name: NF0660_low_2
Description: NF0660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0660_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 36 - 275
Target Start/End: Complemental strand, 46942683 - 46942442
Alignment:
| Q |
36 |
acaatatcaagtatagcaatgagactacattcttattgagattataaacaactttcatcattgattgaaatgaagaggtttcgaacattcttcatgaatc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46942683 |
acaatatcaagtatagcaatgagactacattcttattgagattataaacaactttcatcattgattgaaatgaagaggtttcaaacattcttcatgaatc |
46942584 |
T |
|
| Q |
136 |
atgatccatgtaannnnnnnn--atggaaggactttattccttttcttcgtacttgttaaaatgatctcctccgccttatcatttatgctaaccattttc |
233 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46942583 |
atgatccatgtaattttttttttatggaaggactttattccttttcttcgtacttgttaaaatgatctcctccgccatatcatttatgctaaccattttc |
46942484 |
T |
|
| Q |
234 |
ttcgaagcttgatggcacaattcttcatcaacaatgttcctg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46942483 |
ttcgaagcttgatggcacaattcttcatcaacaatgttcctg |
46942442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2627 times since January 2019
Visitors: 4010