View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0660_low_7 (Length: 281)
Name: NF0660_low_7
Description: NF0660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0660_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 59 - 266
Target Start/End: Complemental strand, 39713611 - 39713403
Alignment:
| Q |
59 |
agtatagctcactattttaacattaggagttatcaatctgtcatatgttctttattccgctgttacatttttatacannnnnnnnn--ctaacttttcaa |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39713611 |
agtatagctcactattttaacattaggagttatcaatctgtcatatgttctttattccgctgttgaatttttatacattttttttcttctaacttttcaa |
39713512 |
T |
 |
| Q |
157 |
ttattgatgtcatttctggttgtaattaaaacaggtatgacaatctcatcattcggttagtggggctaactgtttttgcctttgcaactgcctttatatt |
256 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39713511 |
ttattgatgtcatt-ctggttgtaattaaaacaggtatgacaatctcatcattcggttagtggggctaactgtttttgcctttgcaactgcctttatatt |
39713413 |
T |
 |
| Q |
257 |
actgatgatg |
266 |
Q |
| |
|
||| |||||| |
|
|
| T |
39713412 |
acttatgatg |
39713403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 159 - 266
Target Start/End: Original strand, 22554074 - 22554181
Alignment:
| Q |
159 |
attgatgtcatttctggttgtaattaaaacaggtatgacaatctcatcattcggttagtggggctaactgtttttgcctttgcaactgcctttatattac |
258 |
Q |
| |
|
|||||||||||| ||| ||| |||| || |||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||| |||||| ||| |
|
|
| T |
22554074 |
attgatgtcattgctgattgcaattttaataggtatgacaatcttatcattcggttagtggggctagttgtttttgcatttgcaactgcttttatactac |
22554173 |
T |
 |
| Q |
259 |
tgatgatg |
266 |
Q |
| |
|
| |||||| |
|
|
| T |
22554174 |
ttatgatg |
22554181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University