View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_high_12 (Length: 337)
Name: NF0661_high_12
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0661_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 37036037 - 37035721
Alignment:
Q |
1 |
cgaaccaaagccttccgcaccttgagaacgtcaggcttgtgaaccagagatagaacttggctttgcttccagaactgcgcttctagctttgaaagagaaa |
100 |
Q |
|
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
37036037 |
cgaaccaaagccttccacgccttgagaacgtcaggcttgtgaaccagagatagaacttggctttgcttccagaagtgtgcttctagctttgaaagagaaa |
37035938 |
T |
 |
Q |
101 |
cgaatttccactttgattccagccctggtacgaagtccttcctcctgttcgacgattcactcttccaggccttgcttgcctcgtgcgagaaaagagggaa |
200 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
T |
37035937 |
cgaatttccactttgattccagccttggtacgaagtcattcctcctgttcgacgattcactctttcaggccttgcttgcctcgtgcgagaaaagagagaa |
37035838 |
T |
 |
Q |
201 |
agtgctaacatgctaacaccggtaatgggtgttgccgcatctgagaccggaaaagctgctatttgtccaattctgccttctctctttcctgtatacttct |
300 |
Q |
|
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
37035837 |
agtgataacatgctaacactagtaatgggtgttgccgcatctgagaccggaaaagctgctatttgtccaattctgccttctctctttcctgcatacttct |
37035738 |
T |
 |
Q |
301 |
agtactattgatgatgt |
317 |
Q |
|
|
|||||||||||| |||| |
|
|
T |
37035737 |
agtactattgattatgt |
37035721 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 263 - 319
Target Start/End: Original strand, 21309498 - 21309554
Alignment:
Q |
263 |
ttgtccaattctgccttctctctttcctgtatacttctagtactattgatgatgtcc |
319 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
21309498 |
ttgtccaattctgccttctctctttcctgtatacttctagtactattgatcatgtcc |
21309554 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University