View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_high_17 (Length: 257)
Name: NF0661_high_17
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0661_high_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 7382445 - 7382685
Alignment:
| Q |
30 |
gatcaagttttgaaataaaatattgtctgtacccaatgaataataacggcgcaat-aaaatttataccacgtt----ttatattaattatttttaacaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
7382445 |
gatcaagttttgaaataaaatattgtctgtacccaatgaataataacggcgcaataaaaatttataccacgttttaattatattaattatttttaacaca |
7382544 |
T |
|
| Q |
125 |
tcaataaaaatatattttgtagcactc-------tttgtaagcacataaataagaaatttt-aaagcagtttaagcatatttgtttgtagaaataatatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7382545 |
tcaataaaaatatattttgtagcactctttgtaatttgtaagcacataaataagaaattttaaaagcagtttaagcatatttttttgtagaaataatatt |
7382644 |
T |
|
| Q |
217 |
ttatagctgccagtgtttataaatagatttcttaagccatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7382645 |
ttatagctgccagtgtttataaatagatttcttaagccatt |
7382685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1021 times since January 2019
Visitors: 4109