View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_high_18 (Length: 251)
Name: NF0661_high_18
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0661_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7382843 - 7383079
Alignment:
Q |
1 |
ctcacgacaaagatgcatatgcattgctactactcttgttttaggagtactacaactctattcacggagcaagttgagaacatccaaagtttggataagt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7382843 |
ctcacgacaaagatgcatatgcattgctactactcttgttttaggagtactacaactctattcacggagcaagttgagaacatccaaagtttggataagt |
7382942 |
T |
 |
Q |
101 |
ttgttgaataacttatgaaataaattttaatttgtttgtttgtatactccttcttccatatctttgctagtttaacnnnnnnnnnacttaatcatgctcg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
T |
7382943 |
ttgttgaataacttatgaaataaattttaatttgtttgtttgtatactccttcttccatatctttgctagtttaac--tttttttac-taatcatgctcg |
7383039 |
T |
 |
Q |
201 |
atgcacttgttttctcattcattggttggtcagaatattg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7383040 |
atgcacttgttttctcattcattggttggtcagaatattg |
7383079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1348 times since January 2019
Visitors: 4117