View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_high_21 (Length: 227)
Name: NF0661_high_21
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0661_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 74 - 217
Target Start/End: Complemental strand, 43905767 - 43905624
Alignment:
| Q |
74 |
cgcaattaggattatgtggttttcttttattttacgtttctactttagaaaatatactcttcatcttccttatccattcatgtgatcatcatattcnnnn |
173 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43905767 |
cgcaattaggattatgtggtttccttttattttacgtttctactttagaaaatatactcttcatcttccttatccattcatgtgatcatcatattctttt |
43905668 |
T |
 |
| Q |
174 |
nnnagggagatattattttttgttaaacctttgatgatgtccat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43905667 |
tttagggagatattattttttgttaaacctttgataatgtccat |
43905624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 43905840 - 43905801
Alignment:
| Q |
1 |
gccaataataatagatcaaatagattattaagcaactatt |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43905840 |
gccaataataatagatcaaatagattattaagcaagtatt |
43905801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University