View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_high_23 (Length: 210)
Name: NF0661_high_23
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0661_high_23 |
 | |
|
| [»] scaffold0728 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 30614088 - 30613907
Alignment:
| Q |
1 |
cggttatttgatttatcaaaaaataaatatgcaacatggtggcacaaatatttaacttgcggtgggacgaggggggaggcgtggaagtggagagaagttt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30614088 |
cggttatttgatttatcagaaaataaatatgcaacacggtggcgcaaatatttaacttggggtgggacgaggggggaggcgtggaagtggagagaagttt |
30613989 |
T |
|
| Q |
101 |
acgggtgtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
30613988 |
acgggtgtgggaggaggagttggtagtagaatgtaggttgttattattatatgtggtgttgcatattgatgttgatgatgtc |
30613907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 182
Target Start/End: Original strand, 10382713 - 10382788
Alignment:
| Q |
107 |
gtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc |
182 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
10382713 |
gtgggaggaggagttgttaggggaatctaggttgttattactaactgtggtgttgcaggttaatgttgatgatgtc |
10382788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 17185679 - 17185729
Alignment:
| Q |
132 |
tgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc |
182 |
Q |
| |
|
||||||| | |||||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
17185679 |
tgtaggtcgctattattgaatgttgtgttgcaggttaatgttgatgatgtc |
17185729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0728 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0728
Description:
Target: scaffold0728; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 182
Target Start/End: Original strand, 1426 - 1536
Alignment:
| Q |
73 |
ggggaggcgtggaagtggaga--gaagtttacgggtgtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgat |
170 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||| |||||||||||| || |||| | |||||||||||||||||| ||| ||| |||||||| || |
|
|
| T |
1426 |
ggggaggcatggaagtggagaaggaagtt-acgggcgtgggaggaggaaatgttagtggagtgtaggttgttattattgattgttgtgctgcaggttaat |
1524 |
T |
|
| Q |
171 |
gttgatgatgtc |
182 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1525 |
gttgatgatgtc |
1536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0728; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 182
Target Start/End: Original strand, 6366 - 6476
Alignment:
| Q |
73 |
ggggaggcgtggaagtggaga--gaagtttacgggtgtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgat |
170 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||| |||||||||||| || |||| | |||||||||||||||||| ||| ||| |||||||| || |
|
|
| T |
6366 |
ggggaggcatggaagtggagaaggaagtt-acgggcgtgggaggaggaaatgttagtggagtgtaggttgttattattgattgttgtgctgcaggttaat |
6464 |
T |
|
| Q |
171 |
gttgatgatgtc |
182 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6465 |
gttgatgatgtc |
6476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 143
Target Start/End: Complemental strand, 17620369 - 17620287
Alignment:
| Q |
63 |
tgggacgaggggg-gaggcgtggaagtggag-agaagtttacgggtgtgggaggaggagttggtagtaaaatgtaggttgtta |
143 |
Q |
| |
|
||||||||||||| ||||||||||||||||| || || || ||| ||||||| |||||||||||| | | |||||||||||| |
|
|
| T |
17620369 |
tgggacgagggggagaggcgtggaagtggaggaggaggttgtgggcgtgggagaaggagttggtagcagagtgtaggttgtta |
17620287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 1073826 - 1073776
Alignment:
| Q |
132 |
tgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc |
182 |
Q |
| |
|
|||||| |||||||||||| ||| || ||||||||| |||||||||||||| |
|
|
| T |
1073826 |
tgtaggatgttattattgtctgttgtattgcaggttaatgttgatgatgtc |
1073776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 829 times since January 2019
Visitors: 4101