View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_low_18 (Length: 384)
Name: NF0661_low_18
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0661_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 303
Target Start/End: Original strand, 31207270 - 31207560
Alignment:
| Q |
13 |
gacacaaaataatcttaatgccatcaccatttcaaggtcacataacaccattactccaactagcaaccattctccattcaaaaggcttctcaatcaccat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31207270 |
gacacaaaataatcttaatgccatcaccatttcaaggccacataacaccattactccaactagcaaccattctccattcaaaaggcttctcaatcaccat |
31207369 |
T |
 |
| Q |
113 |
tgttcacacagttttcaactctccaaacccttctgcttaccctcacttcactttccaccctctccacggtgccttgtcggatacggaagcttcaaaggtt |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31207370 |
tgttcacacagtttttaactctccaaacccttcttcttaccctcacttcactttccaccctctccacggtgccttgtccgatacggaagcttcaaaggtt |
31207469 |
T |
 |
| Q |
213 |
gatgcagtgcatcttactgaggttattaatgttagatgtgtgcagcctttgaaggaatgtttgactatgttgttggataaggaagatgatg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31207470 |
gatgcagtgcatcttactgaggttattaatgttagatgtgtgcagcctttgaaggaatgtttgactatgttgttggataaggaagatgatg |
31207560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University