View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_low_20 (Length: 378)
Name: NF0661_low_20
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0661_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 92 - 369
Target Start/End: Original strand, 33745592 - 33745880
Alignment:
Q |
92 |
ggtagtttgtaaaatgaattggtatggtagagaatcaagtatctataaaatgccaaacttatggttactttgagaaggatggataacgccgcaagccaac |
191 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33745592 |
ggtagtttgtaaaattaattggtatggtagagaatcaagtat--ataaaatgccaaacttatggttactttgagaaggatggataacgccgcaagccaac |
33745689 |
T |
 |
Q |
192 |
tgaatgaaaaggtcttaatcacatgtgaaagggtcatgcaattgaga-------------cagttacaaccaattgaggagggaattaggcattttttgg |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33745690 |
tgaatgaaaaggtcttaatcacatgtgaaagggtcatgcaattgagacccctcttaaaatcagttacaaccaattgaggagggaattaggcattttttgg |
33745789 |
T |
 |
Q |
279 |
tgccattcttcaggggagcctttgtcttatacaattgatttgtatcaaaacaaattattggaaaaaagttacaaaaagggtatagaataat |
369 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33745790 |
tgccattcttcaggggagcctttgtcttatacagttgatttgcatcaaaacaaattattggaaaaaagttacaaaaagggtatagaataat |
33745880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1017 times since January 2019
Visitors: 4109