View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0661_low_34 (Length: 248)
Name: NF0661_low_34
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0661_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 13 - 132
Target Start/End: Complemental strand, 24226002 - 24225883
Alignment:
| Q |
13 |
cagagattgtgtgtgggggttcacaatgacatcatgagaagctactccgtcaacaaagttggaattaggaggtattttcctatcaaagaagttgagaagg |
112 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24226002 |
cagagattgtctgtgggggtccacaatgacatcatgagaagatactccttcaacaaagttggaattaggaggtattttcctatcaaagaagttgagaagg |
24225903 |
T |
 |
| Q |
113 |
cggcagttgatggtgctatt |
132 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24225902 |
cggcagttgatggtgctatt |
24225883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 125 - 228
Target Start/End: Complemental strand, 24225319 - 24225216
Alignment:
| Q |
125 |
gtgctattggagcggcgagaggcggagatgacggaagagaggatagacgtaaataagcgaactaaccatggaaggaggggtttgttggttaaggccatga |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24225319 |
gtgctattggagcggcgagaggcggatatgacgaaagagatgatagacgtaaataagcgaactaaacatggaaggaggggtttgttggttaaggccatga |
24225220 |
T |
 |
| Q |
225 |
tgat |
228 |
Q |
| |
|
|||| |
|
|
| T |
24225219 |
tgat |
24225216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University