View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0661_low_38 (Length: 210)

Name: NF0661_low_38
Description: NF0661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0661_low_38
NF0661_low_38
[»] chr6 (3 HSPs)
chr6 (1-182)||(30613907-30614088)
chr6 (107-182)||(10382713-10382788)
chr6 (132-182)||(17185679-17185729)
[»] scaffold0728 (2 HSPs)
scaffold0728 (73-182)||(1426-1536)
scaffold0728 (73-182)||(6366-6476)
[»] chr3 (1 HSPs)
chr3 (63-143)||(17620287-17620369)
[»] chr1 (1 HSPs)
chr1 (132-182)||(1073776-1073826)


Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 30614088 - 30613907
Alignment:
1 cggttatttgatttatcaaaaaataaatatgcaacatggtggcacaaatatttaacttgcggtgggacgaggggggaggcgtggaagtggagagaagttt 100  Q
    |||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
30614088 cggttatttgatttatcagaaaataaatatgcaacacggtggcgcaaatatttaacttggggtgggacgaggggggaggcgtggaagtggagagaagttt 30613989  T
101 acgggtgtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc 182  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||  |||||||||||||||||    
30613988 acgggtgtgggaggaggagttggtagtagaatgtaggttgttattattatatgtggtgttgcatattgatgttgatgatgtc 30613907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 182
Target Start/End: Original strand, 10382713 - 10382788
Alignment:
107 gtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc 182  Q
    |||||||||||||||| |||   ||| ||||||||||||| |   |||||||||||||||| ||||||||||||||    
10382713 gtgggaggaggagttgttaggggaatctaggttgttattactaactgtggtgttgcaggttaatgttgatgatgtc 10382788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 17185679 - 17185729
Alignment:
132 tgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc 182  Q
    ||||||| | |||||||| |||| |||||||||||| ||||||||||||||    
17185679 tgtaggtcgctattattgaatgttgtgttgcaggttaatgttgatgatgtc 17185729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0728 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0728
Description:

Target: scaffold0728; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 182
Target Start/End: Original strand, 1426 - 1536
Alignment:
73 ggggaggcgtggaagtggaga--gaagtttacgggtgtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgat 170  Q
    |||||||| ||||||||||||  |||||| ||||| ||||||||||||  || ||||  | ||||||||||||||||||  ||| ||| |||||||| ||    
1426 ggggaggcatggaagtggagaaggaagtt-acgggcgtgggaggaggaaatgttagtggagtgtaggttgttattattgattgttgtgctgcaggttaat 1524  T
171 gttgatgatgtc 182  Q
    ||||||||||||    
1525 gttgatgatgtc 1536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0728; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 182
Target Start/End: Original strand, 6366 - 6476
Alignment:
73 ggggaggcgtggaagtggaga--gaagtttacgggtgtgggaggaggagttggtagtaaaatgtaggttgttattattgtatgtggtgttgcaggttgat 170  Q
    |||||||| ||||||||||||  |||||| ||||| ||||||||||||  || ||||  | ||||||||||||||||||  ||| ||| |||||||| ||    
6366 ggggaggcatggaagtggagaaggaagtt-acgggcgtgggaggaggaaatgttagtggagtgtaggttgttattattgattgttgtgctgcaggttaat 6464  T
171 gttgatgatgtc 182  Q
    ||||||||||||    
6465 gttgatgatgtc 6476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 143
Target Start/End: Complemental strand, 17620369 - 17620287
Alignment:
63 tgggacgaggggg-gaggcgtggaagtggag-agaagtttacgggtgtgggaggaggagttggtagtaaaatgtaggttgtta 143  Q
    ||||||||||||| ||||||||||||||||| || || ||  ||| ||||||| |||||||||||| | | ||||||||||||    
17620369 tgggacgagggggagaggcgtggaagtggaggaggaggttgtgggcgtgggagaaggagttggtagcagagtgtaggttgtta 17620287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 1073826 - 1073776
Alignment:
132 tgtaggttgttattattgtatgtggtgttgcaggttgatgttgatgatgtc 182  Q
    |||||| |||||||||||| ||| || ||||||||| ||||||||||||||    
1073826 tgtaggatgttattattgtctgttgtattgcaggttaatgttgatgatgtc 1073776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University