View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662-Insertion-4 (Length: 266)
Name: NF0662-Insertion-4
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0662-Insertion-4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 2 - 266
Target Start/End: Complemental strand, 41062326 - 41062062
Alignment:
| Q |
2 |
ccaacacagtacactagcaggcacaatacaaacaaataagaataaggtaatggtttaacatggaatgataattactaataaataataggtaacctgcaac |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41062326 |
ccaaaacagtacactagcaggcacaatacaaacaaataagaataaggtaatggtttaacatggaatgataattactaataaataataggtaacctgcaac |
41062227 |
T |
 |
| Q |
102 |
tgatccgtgtatgtaagttgattaagcatagttttctgggtccacttaatcaattctgatttgatatctgagagtccttcaccacttattgcagaagtag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41062226 |
tgatccgtgtatgtaagttgattaagcatagttttctgggtccacttaatcaattctgatttgatatctgagagtccttcgccacttattgcagaagtag |
41062127 |
T |
 |
| Q |
202 |
gcacaatgctgacagtttgtagtaggatatcattgttattaagaaacatatcagcttttacccca |
266 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41062126 |
gcacaatgctgacagtttgtcgtaggatatcattgttattaagaaacatatcagcttttatccca |
41062062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University