View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0662_high_10 (Length: 289)
Name: NF0662_high_10
Description: NF0662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0662_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 279
Target Start/End: Complemental strand, 32982110 - 32981851
Alignment:
Q |
20 |
gacatcatcacctctgggcttatttatggttaatcatcttctgacttgccactgaagttttcttctttttcccctgattttgcttgtgtagattctaatt |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32982110 |
gacatcatcacctctgggcttatttatggttaatcatcttctgacttgccactgaagttttcttctttttcccctgattttgcttgtgtagattctaatt |
32982011 |
T |
 |
Q |
120 |
gaggttgaccatctacaagatgtccctggtccatacattcagataaagggtgtttctaaagatgctgtggcagcagcaggttcaatgcttaaattggatg |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
32982010 |
gaggttgaccatctacaagatgtccctggtccatacattcagataaagggtgtttctaaagatgctgtggcagcagcaggttcgatgcttaaattggatg |
32981911 |
T |
 |
Q |
220 |
gttcgtatactactaaggtattggcatttttgctttattttagtccctttcttttctctg |
279 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32981910 |
gttcatatactactaaggtattggcatttttgctttattttagtccctttcttttctctg |
32981851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University